Journal: The Journal of Neuroscience
Article Title: d -Serine and d -Alanine Regulate Adaptive Foraging Behavior in Caenorhabditis elegans via the NMDA Receptor
doi: 10.1523/JNEUROSCI.2358-19.2020
Figure Lengend Snippet: Foraging behavior of wild-type, daao-1(tm3673), and serr-1(tm1988) worms during food deprivation. A, Schematic representation of genomic structure of daao-1 and the transgene construct used in this study. Open, gray, and magenta boxes indicate the UTR, coding exon, and mCherry cDNA, respectively. The positions of the PTS1 and tm3673 deletion are indicated. In the daao-1::mCherry transgene construct, mCherry with a C-terminal PTS1 N-terminally fused with full-length DAAO-1 is expressed under the control of the daao-1 promoter. B, Velocities of wild-type, daao-1(tm3673), and serr-1(tm1988) worms. Bar graphs represent means ± SEM. Forward (C) and backward (D) movement times, and reversal frequencies (E) of wild-type and daao-1(tm3673) worms 0–5 and 60–65 min after food removal. Dots represent single worms; bars are means. F, Localization pattern of DAAO-1 in adult hermaphrodites. Confocal images and overlay of confocal and differential interference contrast (DIC) images of transgenic daao-1(tm3673) carrying the daao-1::mCherry transgene on the HT115(DE3) diet and 60 min after food removal. Scale bars: 20 µm. Forward (G) and backward (H) movement times, and reversal frequencies (I) of wild-type, daao-1(tm3673), and transgenic daao-1(tm3673) expressing the daao-1::mCherry transgene on the HT115(DE3) diet 0–5 and 60–65 min after food removal. Dots represent single worms; bars are means. J, Schematic representation of genomic structure of serr-1. Open and gray boxes indicate the UTR and coding exon, respectively. The positions of the tm1988 deletion and T01H8 coding are indicated. K, Relative rskn-1 mRNA expression in well-fed wild-type and serr-1(tm1988) worms. Bar graphs represent means ± SEM. Forward (L) and backward (M) movement times, and reversal frequencies (N) of wild-type, serr-1(tm1988), and transgenic serr-1(tm1988) expressing the serr-1 transgene 0–5 and 60–65 min after food removal. Dots represent single worms; bars are means; *p < 0.05 and **p < 0.01 indicate significant differences. For details, see Materials and Methods, Experimental design and statistical analysis.
Article Snippet: Subsequently, the SalI–EcoRV fragment of pYS1 was subcloned into pAV1997(42_132del) (pYS2). table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Vector or recombinant DNA Source (identifier) pAV1997 Addgene (RRID: Addgene_37831 ) pAV1997(42_132del) This paper mCherry::PTS1 cDNA This paper (pYS1) pAV1997(42_132del)-PTS1 This paper (pYS2) Pdaao-1 This paper (pYS3) Pdaao-1::mCherry::PTS1 This paper (pYS4) daao-1 This paper (pYS5) daao-1::mCherry::PTS1 This paper (pYS6) nrap-1 This paper (pYS7) Pnrap-1 This paper (pYS8) nrap-1::mCherry This paper (pYS9) serr-1 clone Wellcome Trust Sanger Institute (T01H8) Pmyo-2::GFP Addgene (pBN41, RRID: Addgene_86716 ) Open in a separate window List of plasmids used for generation of transgenic strains table ft1 table-wrap mode="anchored" t5 Table 3. caption a7 Primer pair Forward primer Reverse primer #1 GTCGACTCTAGCATGGTGAGCAAGGGC GATATCCTACAACTTCTTCGACTTGTACAGCTCGTCCATGC #2 GCATGCGATCTTCCGTATCCGCC GTCGACTTCTGAAAAATATAGA #3 GTCGACATGCCTAAAATTGCTGTAC GTCGACCTTTTTCATTTTCAGCAC #4 GCATGCTGGAACAGTGTTTGCCTCAT CCCGGGTTCTCGTGATTACCTGCAAT Open in a separate window List of primer sequences used for construction of transgene plasmids To generate the daao-1 promoter-DAAO-1-mCherry fusion construct ( daao-1::mCherry ), a 1987-bp genomic DNA fragment upstream of the daao-1 initiation codon was amplified by PCR using wild-type worm genomic DNA as the template and primer pair #2.
Techniques: Construct, Transgenic Assay, Expressing
